Transcript: Mouse NM_026844.3

Mus musculus COX assembly mitochondrial protein 2 (Cmc2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Cmc2 (66531)
Length:
1440
CDS:
113..352

Additional Resources:

NCBI RefSeq record:
NM_026844.3
NBCI Gene record:
Cmc2 (66531)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026844.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000182365 GCTCTGAAGAACGGAACCATA pLKO.1 446 3UTR 100% 4.950 6.930 N Cmc2 n/a
2 TRCN0000297675 GCTCTGAAGAACGGAACCATA pLKO_005 446 3UTR 100% 4.950 6.930 N Cmc2 n/a
3 TRCN0000182270 GAAGAACGGAACCATAGGGAA pLKO.1 451 3UTR 100% 2.640 3.696 N Cmc2 n/a
4 TRCN0000376040 TTTCGGCCATTGCAACGACCT pLKO_005 211 CDS 100% 2.160 3.024 N Cmc2 n/a
5 TRCN0000178139 GCCGAAGAATATCCTTTCTTA pLKO.1 395 3UTR 100% 0.563 0.788 N Cmc2 n/a
6 TRCN0000279562 GCCGAAGAATATCCTTTCTTA pLKO_005 395 3UTR 100% 0.563 0.788 N Cmc2 n/a
7 TRCN0000200084 CGAAGAATGCAACGTCCTGAT pLKO.1 145 CDS 100% 4.050 3.240 N Cmc2 n/a
8 TRCN0000279243 CCGAAGAATGCAACGTCCTGA pLKO_005 144 CDS 100% 2.640 2.112 N Cmc2 n/a
9 TRCN0000217800 CACAGCACAGCTATCACTTTA pLKO.1 915 3UTR 100% 13.200 9.240 N Cmc2 n/a
10 TRCN0000376075 CGGGAAATGAGGAAGTGTTTG pLKO_005 236 CDS 100% 10.800 7.560 N Cmc2 n/a
11 TRCN0000181915 CCTGCTAAAGGAATGTCACAA pLKO.1 169 CDS 100% 4.950 3.465 N Cmc2 n/a
12 TRCN0000279084 CCTGCTAAAGGAATGTCACAA pLKO_005 169 CDS 100% 4.950 3.465 N Cmc2 n/a
13 TRCN0000198947 GAAGAATGCAACGTCCTGATT pLKO.1 146 CDS 100% 4.950 3.465 N Cmc2 n/a
14 TRCN0000376039 TCCAGAGGAAGCTGGGAGATA pLKO_005 331 CDS 100% 4.950 3.465 N Cmc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026844.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.