Transcript: Mouse NM_026845.4

Mus musculus peptidylprolyl isomerase (cyclophilin)-like 1 (Ppil1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ppil1 (68816)
Length:
1215
CDS:
45..545

Additional Resources:

NCBI RefSeq record:
NM_026845.4
NBCI Gene record:
Ppil1 (68816)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026845.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101318 CTGGACGGCAAGCATACTATT pLKO.1 408 CDS 100% 13.200 18.480 N Ppil1 n/a
2 TRCN0000444912 GACGACGTGAAGATTCTTAAG pLKO_005 507 CDS 100% 10.800 15.120 N Ppil1 n/a
3 TRCN0000101319 TGGCGCATCTATTTATGGCAA pLKO.1 263 CDS 100% 2.640 2.112 N Ppil1 n/a
4 TRCN0000101315 CGTGAGTTCTTCCAGGAATAT pLKO.1 765 3UTR 100% 13.200 9.240 N Ppil1 n/a
5 TRCN0000442701 GATGATAATGTGTAATGATTG pLKO_005 929 3UTR 100% 10.800 7.560 N Ppil1 n/a
6 TRCN0000445152 CAAGTTCCACAGGATCATCAA pLKO_005 197 CDS 100% 4.950 3.465 N Ppil1 n/a
7 TRCN0000101317 GCTACTACAATGGCACCAAGT pLKO.1 181 CDS 100% 4.050 2.835 N Ppil1 n/a
8 TRCN0000101316 CAGTTTGAAGATGAGCTTCAT pLKO.1 285 CDS 100% 0.495 0.347 N Ppil1 n/a
9 TRCN0000454647 TCAAGGACTTCATGATCCAAG pLKO_005 214 CDS 100% 4.050 2.025 Y Ppil1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026845.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03353 pDONR223 100% 88.1% 98.1% None (many diffs) n/a
2 ccsbBroad304_03353 pLX_304 0% 88.1% 98.1% V5 (many diffs) n/a
3 TRCN0000473695 GAGACGCCGTACGACATTTTTAAA pLX_317 73.5% 88.1% 98.1% V5 (many diffs) n/a
Download CSV