Transcript: Mouse NM_026887.3

Mus musculus adaptor-related protein complex 1, sigma 2 subunit (Ap1s2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Ap1s2 (108012)
Length:
3327
CDS:
258..740

Additional Resources:

NCBI RefSeq record:
NM_026887.3
NBCI Gene record:
Ap1s2 (108012)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026887.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113132 GCAAGAGTTTCATTGGGTATA pLKO.1 706 CDS 100% 10.800 15.120 N Ap1s2 n/a
2 TRCN0000312364 GCAAGAGTTTCATTGGGTATA pLKO_005 706 CDS 100% 10.800 15.120 N Ap1s2 n/a
3 TRCN0000113131 CCTGGAAATAATCCATCGTTA pLKO.1 494 CDS 100% 4.950 6.930 N Ap1s2 n/a
4 TRCN0000113130 GCCACATTTATGCAGTGTCAA pLKO.1 2447 3UTR 100% 4.950 6.930 N Ap1s2 n/a
5 TRCN0000312389 GCCACATTTATGCAGTGTCAA pLKO_005 2447 3UTR 100% 4.950 6.930 N Ap1s2 n/a
6 TRCN0000113133 AGCAAGAGTTTCATTGGGTAT pLKO.1 705 CDS 100% 4.050 5.670 N Ap1s2 n/a
7 TRCN0000313401 GTGAACTTGATATCATCTTTA pLKO_005 550 CDS 100% 13.200 9.240 N Ap1s2 n/a
8 TRCN0000313402 CTATTGAGGATCAGGACAATG pLKO_005 463 CDS 100% 10.800 7.560 N Ap1s2 n/a
9 TRCN0000113134 CGTGGAATTACTTGACAAGTA pLKO.1 515 CDS 100% 4.950 3.465 N Ap1s2 n/a
10 TRCN0000312363 CGTGGAATTACTTGACAAGTA pLKO_005 515 CDS 100% 4.950 3.465 N Ap1s2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026887.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02047 pDONR223 100% 88.4% 91.2% None (many diffs) n/a
2 ccsbBroad304_02047 pLX_304 0% 88.4% 91.2% V5 (many diffs) n/a
3 TRCN0000473696 CCATGTTTTGTACAACTTATCTTT pLX_317 86.3% 88.4% 91.2% V5 (many diffs) n/a
Download CSV