Transcript: Mouse NM_026912.1

Mus musculus sorting nexin 15 (Snx15), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Snx15 (69024)
Length:
1554
CDS:
69..1082

Additional Resources:

NCBI RefSeq record:
NM_026912.1
NBCI Gene record:
Snx15 (69024)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026912.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093456 CAAGGGTTACACAGAGTACAA pLKO.1 134 CDS 100% 4.950 6.930 N Snx15 n/a
2 TRCN0000319660 TTGGCCTATACTCACCGAAAC pLKO_005 252 CDS 100% 6.000 4.200 N Snx15 n/a
3 TRCN0000319593 ACTCAAGCCCTGCGGAATGAA pLKO_005 897 CDS 100% 5.625 3.938 N Snx15 n/a
4 TRCN0000319592 AGGATATCAAAGAGGTAGTAG pLKO_005 190 CDS 100% 4.950 3.465 N Snx15 n/a
5 TRCN0000093458 GTACAAAGTAACCGCTCAGTT pLKO.1 149 CDS 100% 4.950 3.465 N Snx15 n/a
6 TRCN0000317842 GTACAAAGTAACCGCTCAGTT pLKO_005 149 CDS 100% 4.950 3.465 N Snx15 n/a
7 TRCN0000093455 CTTGGCCTATACTCACCGAAA pLKO.1 251 CDS 100% 4.050 2.835 N Snx15 n/a
8 TRCN0000093454 CCATATCTGTATTAACTGGAT pLKO.1 1184 3UTR 100% 2.640 1.848 N Snx15 n/a
9 TRCN0000317843 CCATATCTGTATTAACTGGAT pLKO_005 1184 3UTR 100% 2.640 1.848 N Snx15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026912.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03101 pDONR223 100% 83.6% 86.5% None (many diffs) n/a
2 ccsbBroad304_03101 pLX_304 0% 83.6% 86.5% V5 (many diffs) n/a
3 TRCN0000470975 TGTCTCCAACTTTACCCCAATATA pLX_317 52.9% 83.6% 86.5% V5 (many diffs) n/a
Download CSV