Transcript: Mouse NM_026917.5

Mus musculus zinc finger, DHHC domain containing 3 (Zdhhc3), mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Zdhhc3 (69035)
Length:
6987
CDS:
235..1134

Additional Resources:

NCBI RefSeq record:
NM_026917.5
NBCI Gene record:
Zdhhc3 (69035)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026917.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120664 CCCAAAGGAAATGCCACTAAA pLKO.1 550 CDS 100% 13.200 9.240 N Zdhhc3 n/a
2 TRCN0000162755 CCCAAAGGAAATGCCACTAAA pLKO.1 550 CDS 100% 13.200 9.240 N ZDHHC3 n/a
3 TRCN0000345219 CCCAAAGGAAATGCCACTAAA pLKO_005 550 CDS 100% 13.200 9.240 N Zdhhc3 n/a
4 TRCN0000120662 CCCAGCAAGATGTCAGTCATT pLKO.1 1872 3UTR 100% 4.950 3.465 N Zdhhc3 n/a
5 TRCN0000345158 CCCAGCAAGATGTCAGTCATT pLKO_005 1872 3UTR 100% 4.950 3.465 N Zdhhc3 n/a
6 TRCN0000120663 GCGGAGTTTGTAGTCCTCTTT pLKO.1 406 CDS 100% 4.950 3.465 N Zdhhc3 n/a
7 TRCN0000345153 GCGGAGTTTGTAGTCCTCTTT pLKO_005 406 CDS 100% 4.950 3.465 N Zdhhc3 n/a
8 TRCN0000120665 GCCATGTGGTTTATCCGAGAT pLKO.1 337 CDS 100% 4.050 2.835 N Zdhhc3 n/a
9 TRCN0000345216 GCCATGTGGTTTATCCGAGAT pLKO_005 337 CDS 100% 4.050 2.835 N Zdhhc3 n/a
10 TRCN0000120666 GCTTTGAAGAAGACTGGACAA pLKO.1 824 CDS 100% 4.050 2.835 N Zdhhc3 n/a
11 TRCN0000345155 GCTTTGAAGAAGACTGGACAA pLKO_005 824 CDS 100% 4.050 2.835 N Zdhhc3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026917.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.