Transcript: Mouse NM_026943.1

Mus musculus small nuclear ribonucleoprotein D2 (Snrpd2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Snrpd2 (107686)
Length:
508
CDS:
56..412

Additional Resources:

NCBI RefSeq record:
NM_026943.1
NBCI Gene record:
Snrpd2 (107686)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026943.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112025 GCTCATTAACTGTCGCAACAA pLKO.1 181 CDS 100% 4.950 6.930 N Snrpd2 n/a
2 TRCN0000316847 GCTCATTAACTGTCGCAACAA pLKO_005 181 CDS 100% 4.950 6.930 N Snrpd2 n/a
3 TRCN0000112027 TCGGTCAAGAACAACACGCAA pLKO.1 158 CDS 100% 2.640 3.696 N Snrpd2 n/a
4 TRCN0000349197 TCGGTCAAGAACAACACGCAA pLKO_005 158 CDS 100% 2.640 3.696 N Snrpd2 n/a
5 TRCN0000112029 ACTGCAACATGGTGCTGGAAA pLKO.1 240 CDS 100% 4.950 3.465 N Snrpd2 n/a
6 TRCN0000305244 GGACCGCTACATCTCCAAGAT pLKO_005 331 CDS 100% 4.950 3.465 N Snrpd2 n/a
7 TRCN0000112028 CAAGGGCAAGAAGAAATCCAA pLKO.1 298 CDS 100% 3.000 2.100 N Snrpd2 n/a
8 TRCN0000074398 CCGCTACATCTCCAAGATGTT pLKO.1 334 CDS 100% 0.495 0.347 N SNRPD2 n/a
9 TRCN0000301103 CCGCTACATCTCCAAGATGTT pLKO_005 334 CDS 100% 0.495 0.347 N SNRPD2 n/a
10 TRCN0000112026 GAAGAAATCCAAGCCTGTCAA pLKO.1 307 CDS 100% 4.950 2.970 N Snrpd2 n/a
11 TRCN0000316853 GAAGAAATCCAAGCCTGTCAA pLKO_005 307 CDS 100% 4.950 2.970 N Snrpd2 n/a
12 TRCN0000305243 AGGAGATGTGGACTGAGGTTC pLKO_005 267 CDS 100% 4.050 2.430 N Snrpd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026943.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01571 pDONR223 100% 91.2% 100% None (many diffs) n/a
2 ccsbBroad304_01571 pLX_304 0% 91.2% 100% V5 (many diffs) n/a
3 TRCN0000478535 GGTGTACGTTAGAAACCGGCCGGG pLX_317 95.7% 91.2% 100% V5 (many diffs) n/a
Download CSV