Transcript: Mouse NM_027002.3

Mus musculus polymerase (RNA) II (DNA directed) polypeptide D (Polr2d), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Polr2d (69241)
Length:
956
CDS:
14..442

Additional Resources:

NCBI RefSeq record:
NM_027002.3
NBCI Gene record:
Polr2d (69241)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027002.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114678 CTGTCGGAGGTCTTCATGAAA pLKO.1 182 CDS 100% 5.625 3.938 N Polr2d n/a
2 TRCN0000353914 CTGTCGGAGGTCTTCATGAAA pLKO_005 182 CDS 100% 5.625 3.938 N Polr2d n/a
3 TRCN0000114680 TCTCGATGACATCCAGACGAA pLKO.1 403 CDS 100% 2.640 1.848 N Polr2d n/a
4 TRCN0000324108 TCTCGATGACATCCAGACGAA pLKO_005 403 CDS 100% 2.640 1.848 N Polr2d n/a
5 TRCN0000114676 CCTGAACTGCTGAGGTAGAAT pLKO.1 791 3UTR 100% 5.625 3.375 N Polr2d n/a
6 TRCN0000353913 CCTGAACTGCTGAGGTAGAAT pLKO_005 791 3UTR 100% 5.625 3.375 N Polr2d n/a
7 TRCN0000114677 TGGCCTGTTTAGCCAATCTTT pLKO.1 303 CDS 100% 5.625 3.375 N Polr2d n/a
8 TRCN0000114679 GAGACTGCTGAAGAGTCCAAA pLKO.1 329 CDS 100% 4.950 2.475 Y Polr2d n/a
9 TRCN0000324168 GAGACTGCTGAAGAGTCCAAA pLKO_005 329 CDS 100% 4.950 2.475 Y Polr2d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027002.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01238 pDONR223 100% 87.5% 100% None (many diffs) n/a
2 ccsbBroad304_01238 pLX_304 0% 87.5% 100% V5 (many diffs) n/a
3 TRCN0000465902 ACATAGTAGAATTAAACCTCGTAC pLX_317 86.5% 87.5% 100% V5 (many diffs) n/a
Download CSV