Transcript: Mouse NM_027081.3

Mus musculus DENN/MADD domain containing 6B (Dennd6b), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Dennd6b (69440)
Length:
4716
CDS:
80..1837

Additional Resources:

NCBI RefSeq record:
NM_027081.3
NBCI Gene record:
Dennd6b (69440)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027081.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180250 CCAAAGCAGGTCAAGCTTAAA pLKO.1 1160 CDS 100% 13.200 9.240 N Dennd6b n/a
2 TRCN0000122162 GAGTCACAAACCCTTTCTTTA pLKO.1 1074 CDS 100% 13.200 9.240 N DENND6B n/a
3 TRCN0000196236 GCTGCTTAAACGACTGCTCAA pLKO.1 1261 CDS 100% 4.050 2.835 N Dennd6b n/a
4 TRCN0000180378 GATACAGTTATTGGCTCCCTT pLKO.1 1781 CDS 100% 2.640 1.848 N Dennd6b n/a
5 TRCN0000184100 CCTGAAGTTCTGCTGTGACTT pLKO.1 973 CDS 100% 4.950 2.970 N Dennd6b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027081.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10154 pDONR223 100% 86% 91.2% None (many diffs) n/a
2 ccsbBroad304_10154 pLX_304 0% 86% 91.2% V5 (many diffs) n/a
3 TRCN0000481297 CCTCCCTGTAGCTGTAGCCGACGT pLX_317 25% 86% 91.2% V5 (many diffs) n/a
Download CSV