Transcript: Mouse NM_027130.1

Mus musculus AFG3-like AAA ATPase 2 (Afg3l2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Afg3l2 (69597)
Length:
3086
CDS:
136..2544

Additional Resources:

NCBI RefSeq record:
NM_027130.1
NBCI Gene record:
Afg3l2 (69597)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027130.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241172 GGCAATACGTCTGGTTTAATA pLKO_005 758 CDS 100% 15.000 21.000 N Afg3l2 n/a
2 TRCN0000241170 CTCCGTACGCTCTATCAATAT pLKO_005 241 CDS 100% 13.200 18.480 N Afg3l2 n/a
3 TRCN0000241173 TGTTGCCCACCGTACTCATTA pLKO_005 902 CDS 100% 13.200 18.480 N Afg3l2 n/a
4 TRCN0000241174 CTTTGTCAATAACTATCTTTC pLKO_005 654 CDS 100% 10.800 15.120 N Afg3l2 n/a
5 TRCN0000241171 ACCGGGTCCCTGTGGTTTATA pLKO_005 848 CDS 100% 15.000 10.500 N Afg3l2 n/a
6 TRCN0000051489 GCCAAGGTCTTAAAGGATGAA pLKO.1 1018 CDS 100% 4.950 3.465 N AFG3L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027130.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07709 pDONR223 100% 84.2% 92.4% None (many diffs) n/a
2 ccsbBroad304_07709 pLX_304 0% 84.2% 92.4% V5 (many diffs) n/a
3 TRCN0000476795 CACCGGTGCGAAGTCTACCAGCGG pLX_317 14.1% 84.2% 92.4% V5 (many diffs) n/a
Download CSV