Transcript: Mouse NM_027211.2

Mus musculus annexin A13 (Anxa13), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Anxa13 (69787)
Length:
1408
CDS:
45..998

Additional Resources:

NCBI RefSeq record:
NM_027211.2
NBCI Gene record:
Anxa13 (69787)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027211.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098097 CACACGAAGCAACAAGGAAAT pLKO.1 389 CDS 100% 10.800 7.560 N Anxa13 n/a
2 TRCN0000332654 CACACGAAGCAACAAGGAAAT pLKO_005 389 CDS 100% 10.800 7.560 N Anxa13 n/a
3 TRCN0000098099 CAGAAGTACAAGGAGAAGTAT pLKO.1 207 CDS 100% 5.625 3.938 N Anxa13 n/a
4 TRCN0000332658 CAGAAGTACAAGGAGAAGTAT pLKO_005 207 CDS 100% 5.625 3.938 N Anxa13 n/a
5 TRCN0000098098 GAGACATTAATTCGCATCATT pLKO.1 843 CDS 100% 5.625 3.938 N Anxa13 n/a
6 TRCN0000332581 GAGACATTAATTCGCATCATT pLKO_005 843 CDS 100% 5.625 3.938 N Anxa13 n/a
7 TRCN0000098096 CCATGCTCATAGAGATCCTAT pLKO.1 367 CDS 100% 4.950 3.465 N Anxa13 n/a
8 TRCN0000332579 CCATGCTCATAGAGATCCTAT pLKO_005 367 CDS 100% 4.950 3.465 N Anxa13 n/a
9 TRCN0000098095 GCGAATGCTTTCTAAGCACAA pLKO.1 1235 3UTR 100% 4.050 2.835 N Anxa13 n/a
10 TRCN0000332656 GCGAATGCTTTCTAAGCACAA pLKO_005 1235 3UTR 100% 4.050 2.835 N Anxa13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027211.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05827 pDONR223 100% 85.2% 86.4% None (many diffs) n/a
2 ccsbBroad304_05827 pLX_304 0% 85.2% 86.4% V5 (many diffs) n/a
3 TRCN0000475407 GAGGTACGTGATGTCCGAGGATCC pLX_317 51.2% 85.2% 86.4% V5 (many diffs) n/a
Download CSV