Transcript: Mouse NM_027238.2

Mus musculus tetratricopeptide repeat domain 39B (Ttc39b), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ttc39b (69863)
Length:
8764
CDS:
78..1931

Additional Resources:

NCBI RefSeq record:
NM_027238.2
NBCI Gene record:
Ttc39b (69863)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027238.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000297692 ACGCTGTTTGAGTTGGCATTT pLKO_005 1764 CDS 100% 10.800 15.120 N Ttc39b n/a
2 TRCN0000202148 CGTTCCTTCAACAGTTCCCAA pLKO.1 1033 CDS 100% 2.640 3.696 N Ttc39b n/a
3 TRCN0000200556 CCATGATCCATCAAATAAGAA pLKO.1 2013 3UTR 100% 5.625 4.500 N Ttc39b n/a
4 TRCN0000279586 ACTGCAAGAAATAACTATAAG pLKO_005 1833 CDS 100% 13.200 9.240 N Ttc39b n/a
5 TRCN0000279588 GGATGCAGGCGTATTACTATT pLKO_005 1222 CDS 100% 13.200 9.240 N Ttc39b n/a
6 TRCN0000279587 GGTACAATAAAGCCTAGTTAG pLKO_005 2197 3UTR 100% 10.800 7.560 N Ttc39b n/a
7 TRCN0000192511 GATGATGAATGCTTGGTGAAA pLKO.1 1626 CDS 100% 4.950 3.465 N Ttc39b n/a
8 TRCN0000189953 GCGGCTTTCACTTTGTACCAT pLKO.1 178 CDS 100% 3.000 2.100 N Ttc39b n/a
9 TRCN0000191967 GCACTGAACTTATTTCTAAGT pLKO.1 306 CDS 100% 0.495 0.347 N Ttc39b n/a
10 TRCN0000297304 GCACTGAACTTATTTCTAAGT pLKO_005 306 CDS 100% 0.495 0.347 N Ttc39b n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 7285 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027238.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14414 pDONR223 100% 83.8% 87.3% None (many diffs) n/a
2 ccsbBroad304_14414 pLX_304 0% 83.8% 87.3% V5 (many diffs) n/a
Download CSV