Transcript: Mouse NM_027326.3

Mus musculus myeloid/lymphoid or mixed-lineage leukemia; translocated to, 3 (Mllt3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Mllt3 (70122)
Length:
6129
CDS:
313..2022

Additional Resources:

NCBI RefSeq record:
NM_027326.3
NBCI Gene record:
Mllt3 (70122)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027326.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096700 CCGCTTTGATTATGACTTATT pLKO.1 606 CDS 100% 13.200 18.480 N Mllt3 n/a
2 TRCN0000096701 CCGCTGTGAGAAACTAACTTT pLKO.1 663 CDS 100% 5.625 4.500 N Mllt3 n/a
3 TRCN0000096703 CGGAGATGGAAAGACCTGTAA pLKO.1 1601 CDS 100% 4.950 3.960 N Mllt3 n/a
4 TRCN0000096699 CCAGTCATCATCTCTTGATAA pLKO.1 2175 3UTR 100% 13.200 9.240 N Mllt3 n/a
5 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4866 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027326.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06586 pDONR223 100% 92.5% 97.7% None (many diffs) n/a
2 ccsbBroad304_06586 pLX_304 0% 92.5% 97.7% V5 (many diffs) n/a
3 TRCN0000476406 GACTACCTTAACAGATAGCATGAA pLX_317 18.4% 92.5% 97.7% V5 (many diffs) n/a
Download CSV