Transcript: Mouse NM_027769.3

Mus musculus copine III (Cpne3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-02-27
Taxon:
Mus musculus (mouse)
Gene:
Cpne3 (70568)
Length:
5666
CDS:
117..1718

Additional Resources:

NCBI RefSeq record:
NM_027769.3
NBCI Gene record:
Cpne3 (70568)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027769.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244931 TTCACCGAACAGAGGTTATAA pLKO_005 646 CDS 100% 15.000 21.000 N Cpne3 n/a
2 TRCN0000077138 CCCAGCTTAAATACAAACTAA pLKO.1 3467 3UTR 100% 5.625 7.875 N Cpne3 n/a
3 TRCN0000077141 GATGAACTTTAACCCATCGAA pLKO.1 1202 CDS 100% 3.000 4.200 N Cpne3 n/a
4 TRCN0000244933 ACTCTATGGACCAACTAATTT pLKO_005 1286 CDS 100% 15.000 12.000 N Cpne3 n/a
5 TRCN0000320438 ACTCTATGGACCAACTAATTT pLKO_005 1286 CDS 100% 15.000 12.000 N CPNE3 n/a
6 TRCN0000244934 TAGGCATAAAGCCTGATATAA pLKO_005 2887 3UTR 100% 15.000 10.500 N Cpne3 n/a
7 TRCN0000244930 TGCAGGGAAAGGGAGTATTAC pLKO_005 482 CDS 100% 13.200 9.240 N Cpne3 n/a
8 TRCN0000244932 CTGGTCTGTAGGATTGGTAAT pLKO_005 1094 CDS 100% 10.800 7.560 N Cpne3 n/a
9 TRCN0000077140 GCAGACAGCTTCTCAATACTT pLKO.1 1358 CDS 100% 5.625 3.938 N Cpne3 n/a
10 TRCN0000077139 GCATGATCTCATTGGAACATT pLKO.1 782 CDS 100% 5.625 3.938 N Cpne3 n/a
11 TRCN0000077142 CCTGTTGAATATGAATGCATA pLKO.1 846 CDS 100% 4.950 3.465 N Cpne3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027769.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.