Transcript: Mouse NM_027865.2

Mus musculus transmembrane protein 25 (Tmem25), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Tmem25 (71687)
Length:
2354
CDS:
61..1158

Additional Resources:

NCBI RefSeq record:
NM_027865.2
NBCI Gene record:
Tmem25 (71687)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027865.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125938 GCTCCCAACATGAGCTTAACT pLKO.1 359 CDS 100% 5.625 7.875 N Tmem25 n/a
2 TRCN0000438617 AGGTGTCACCCAACATCTAAG pLKO_005 1466 3UTR 100% 10.800 8.640 N Tmem25 n/a
3 TRCN0000125935 CCATCCAACCTTCAGCTCAAT pLKO.1 955 CDS 100% 4.950 3.465 N Tmem25 n/a
4 TRCN0000125937 GTGCAATTCAAACCAGAGATT pLKO.1 436 CDS 100% 4.950 3.465 N Tmem25 n/a
5 TRCN0000137565 CTCAATGACCTCACTCCAGAT pLKO.1 970 CDS 100% 4.050 2.835 N TMEM25 n/a
6 TRCN0000125936 GCCCTCTTAAGTTCAGGTCAA pLKO.1 115 CDS 100% 4.050 2.835 N Tmem25 n/a
7 TRCN0000125934 GCCTATTATATGTCCTACCTT pLKO.1 1493 3UTR 100% 3.000 2.100 N Tmem25 n/a
8 TRCN0000431865 CCAATAACCTGAAACTGAATA pLKO_005 902 CDS 100% 13.200 7.920 N Tmem25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027865.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09228 pDONR223 100% 76.6% 79.7% None (many diffs) n/a
2 ccsbBroad304_09228 pLX_304 0% 76.6% 79.7% V5 (many diffs) n/a
3 TRCN0000471803 GTGCACCCAGGGCCGTGACTGGAG pLX_317 37.8% 76.6% 79.7% V5 (many diffs) n/a
Download CSV