Transcript: Mouse NM_027869.1

Mus musculus polyribonucleotide nucleotidyltransferase 1 (Pnpt1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Pnpt1 (71701)
Length:
2704
CDS:
8..2359

Additional Resources:

NCBI RefSeq record:
NM_027869.1
NBCI Gene record:
Pnpt1 (71701)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027869.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111313 CGAGTAATAGATCGTTCAATT pLKO.1 401 CDS 100% 13.200 18.480 N Pnpt1 n/a
2 TRCN0000334498 CGAGTAATAGATCGTTCAATT pLKO_005 401 CDS 100% 13.200 18.480 N Pnpt1 n/a
3 TRCN0000111311 GCCGGTACAAATAAAGGAATA pLKO.1 1649 CDS 100% 10.800 15.120 N Pnpt1 n/a
4 TRCN0000334544 GCCGGTACAAATAAAGGAATA pLKO_005 1649 CDS 100% 10.800 15.120 N Pnpt1 n/a
5 TRCN0000111310 GCGATATTCTGTGGAGCAAAT pLKO.1 2384 3UTR 100% 10.800 15.120 N Pnpt1 n/a
6 TRCN0000111312 CCGGTACAAATAAAGGAATAA pLKO.1 1650 CDS 100% 13.200 10.560 N Pnpt1 n/a
7 TRCN0000312600 CTGCATTACAGGCTGATATTA pLKO_005 1671 CDS 100% 15.000 10.500 N PNPT1 n/a
8 TRCN0000111314 CGGCAAAGTTACTGGTGTGAA pLKO.1 1318 CDS 100% 4.950 3.465 N Pnpt1 n/a
9 TRCN0000334543 CGGCAAAGTTACTGGTGTGAA pLKO_005 1318 CDS 100% 4.950 3.465 N Pnpt1 n/a
10 TRCN0000348319 ATTTCAGGAGCAACCTATATT pLKO_005 2486 3UTR 100% 15.000 9.000 N Pnpt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027869.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09270 pDONR223 100% 87.1% 90.8% None (many diffs) n/a
2 TRCN0000477871 TGTAACACCCCAATTATTCCGGCA pLX_317 20.7% 87.1% 90.8% V5 (many diffs) n/a
Download CSV