Transcript: Mouse NM_027908.1

Mus musculus amidohydrolase domain containing 1 (Amdhd1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Amdhd1 (71761)
Length:
2421
CDS:
64..1344

Additional Resources:

NCBI RefSeq record:
NM_027908.1
NBCI Gene record:
Amdhd1 (71761)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027908.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032789 CGGATCTTTGGAAGTTGGCAA pLKO.1 1203 CDS 100% 2.640 3.696 N Amdhd1 n/a
2 TRCN0000032793 GACCTGCATGTTGACAACATA pLKO.1 730 CDS 100% 5.625 3.938 N Amdhd1 n/a
3 TRCN0000032792 CCACGAGTTTGCAATGAAGTT pLKO.1 354 CDS 100% 4.950 3.465 N Amdhd1 n/a
4 TRCN0000032791 GCCACCATCAACGCGGCTTAT pLKO.1 1159 CDS 100% 3.600 2.520 N Amdhd1 n/a
5 TRCN0000032790 GCTGAAGGAACTCAGCAGAAA pLKO.1 705 CDS 100% 0.495 0.347 N Amdhd1 n/a
6 TRCN0000046962 GCTGCTGATGACATCATCAAT pLKO.1 670 CDS 100% 0.563 0.394 N AMDHD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027908.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09609 pDONR223 100% 87.5% 88.9% None (many diffs) n/a
2 ccsbBroad304_09609 pLX_304 0% 87.5% 88.9% V5 (many diffs) n/a
3 TRCN0000491806 TCGGTACGTCCCATTGGTAGTATC pLX_317 27.8% 87.5% 88.9% V5 (many diffs) n/a
Download CSV