Transcript: Mouse NM_027924.2

Mus musculus platelet-derived growth factor, D polypeptide (Pdgfd), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Pdgfd (71785)
Length:
1795
CDS:
184..1296

Additional Resources:

NCBI RefSeq record:
NM_027924.2
NBCI Gene record:
Pdgfd (71785)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027924.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067712 TGCGCGAACTTTAGCTGCTAT pLKO.1 217 CDS 100% 4.950 6.930 N Pdgfd n/a
2 TRCN0000067708 CCTATCACTCTCCATCAATAA pLKO.1 764 CDS 100% 13.200 9.240 N Pdgfd n/a
3 TRCN0000067710 GTCAAGAACAAACCAGATTAA pLKO.1 606 CDS 100% 13.200 9.240 N Pdgfd n/a
4 TRCN0000067711 CCAGTGTCTTGGCAAGATGAT pLKO.1 868 CDS 100% 4.950 3.465 N Pdgfd n/a
5 TRCN0000067709 GCTAAGAATATGGCTCTTGTT pLKO.1 1213 CDS 100% 4.950 3.465 N Pdgfd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027924.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04204 pDONR223 100% 84.4% 83.5% None (many diffs) n/a
2 ccsbBroad304_04204 pLX_304 0% 84.4% 83.5% V5 (many diffs) n/a
3 TRCN0000473608 TGAAGAACCAATTTCGAATACATA pLX_317 48.7% 84.4% 83.5% V5 (many diffs) n/a
Download CSV