Transcript: Mouse NM_027946.3

Mus musculus DDB1 and CUL4 associated factor 7 (Dcaf7), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Dcaf7 (71833)
Length:
5765
CDS:
253..1281

Additional Resources:

NCBI RefSeq record:
NM_027946.3
NBCI Gene record:
Dcaf7 (71833)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027946.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114648 CCAGCTAATTGCCCATGACAA pLKO.1 756 CDS 100% 4.950 3.960 N Dcaf7 n/a
2 TRCN0000114647 GATCGCTATCTGCTACAACAA pLKO.1 1236 CDS 100% 4.950 3.960 N Dcaf7 n/a
3 TRCN0000147504 GTTCAGCTTGTTGGTTTAGAT pLKO.1 391 CDS 100% 5.625 3.938 N DCAF7 n/a
4 TRCN0000343203 GTTCAGCTTGTTGGTTTAGAT pLKO_005 391 CDS 100% 5.625 3.938 N DCAF7 n/a
5 TRCN0000114650 CAACAACAAGAACTCAGACTT pLKO.1 588 CDS 100% 4.950 3.465 N Dcaf7 n/a
6 TRCN0000114649 CCTGACACAAAGGGCGTCTAT pLKO.1 484 CDS 100% 4.950 3.465 N Dcaf7 n/a
7 TRCN0000114646 CGCATGTGTATGACCTGACTT pLKO.1 5363 3UTR 100% 4.950 3.465 N Dcaf7 n/a
8 TRCN0000131156 GCCCATGACAAAGAGGTCTAT pLKO.1 766 CDS 100% 4.950 3.465 N DCAF7 n/a
9 TRCN0000149534 GTTGGTTTAGATGAGGAGAGT pLKO.1 400 CDS 100% 2.640 1.848 N DCAF7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027946.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02366 pDONR223 100% 92% 100% None (many diffs) n/a
2 ccsbBroad304_02366 pLX_304 0% 92% 100% V5 (many diffs) n/a
3 TRCN0000471176 CACTCATGCGAATTCTGACGGGGG pLX_317 40.2% 92% 100% V5 (many diffs) n/a
Download CSV