Transcript: Mouse NM_028071.3

Mus musculus coactosin-like 1 (Dictyostelium) (Cotl1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Cotl1 (72042)
Length:
1642
CDS:
180..608

Additional Resources:

NCBI RefSeq record:
NM_028071.3
NBCI Gene record:
Cotl1 (72042)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028071.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000277104 CTACGACGCTCAGTCAGAGTA pLKO_005 587 CDS 100% 4.950 3.960 N Cotl1 n/a
2 TRCN0000184279 GAGCAGATTACCAGCACTTCA pLKO.1 304 CDS 100% 4.950 3.960 N Cotl1 n/a
3 TRCN0000320007 GAGCAGATTACCAGCACTTCA pLKO_005 304 CDS 100% 4.950 3.960 N Cotl1 n/a
4 TRCN0000196183 GTTTGCCCTCATCACATGGAT pLKO.1 404 CDS 100% 3.000 2.400 N Cotl1 n/a
5 TRCN0000277052 GAAGGAGGTGGTCCAGAATTT pLKO_005 482 CDS 100% 13.200 9.240 N Cotl1 n/a
6 TRCN0000277105 CAAGCTCACCAAGCATCATTC pLKO_005 764 3UTR 100% 10.800 7.560 N Cotl1 n/a
7 TRCN0000184102 CCAAGTTTGCCCTCATCACAT pLKO.1 400 CDS 100% 4.950 3.465 N Cotl1 n/a
8 TRCN0000184354 GATCCAAGTTTGCCCTCATCA pLKO.1 397 CDS 100% 4.950 3.465 N Cotl1 n/a
9 TRCN0000350228 GATCCAAGTTTGCCCTCATCA pLKO_005 397 CDS 100% 4.950 3.465 N Cotl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028071.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07879 pDONR223 100% 87.5% 94.3% None (many diffs) n/a
2 ccsbBroad304_07879 pLX_304 0% 87.5% 94.3% V5 (many diffs) n/a
3 TRCN0000469021 ATTCTACCGAGCATCACCAGCTCC pLX_317 87.6% 87.5% 94.3% V5 (many diffs) n/a
Download CSV