Transcript: Mouse NM_028112.2

Mus musculus SEH1-like (S. cerevisiae (Seh1l), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Seh1l (72124)
Length:
1783
CDS:
135..1208

Additional Resources:

NCBI RefSeq record:
NM_028112.2
NBCI Gene record:
Seh1l (72124)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028112.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366169 GGTAACGGGAGCCCAGTAAAT pLKO_005 1095 CDS 100% 13.200 18.480 N Seh1l n/a
2 TRCN0000348400 TCTCCTGGTAGTCATACTAAA pLKO_005 1448 3UTR 100% 13.200 18.480 N Seh1l n/a
3 TRCN0000093264 CACCAATAATTGTGACACTTA pLKO.1 1499 3UTR 100% 4.950 6.930 N Seh1l n/a
4 TRCN0000093267 CCTCTGTTACTGATGTGAAAT pLKO.1 475 CDS 100% 13.200 9.240 N Seh1l n/a
5 TRCN0000335047 CCTCTGTTACTGATGTGAAAT pLKO_005 475 CDS 100% 13.200 9.240 N Seh1l n/a
6 TRCN0000374855 GTGATGATAGCAGTCCAAATT pLKO_005 691 CDS 100% 13.200 9.240 N Seh1l n/a
7 TRCN0000374856 TTAGTGGCTTCCTTGGTTATA pLKO_005 1547 3UTR 100% 13.200 9.240 N Seh1l n/a
8 TRCN0000093266 CCACGATGTGTCTTTCGACTT pLKO.1 179 CDS 100% 4.050 2.835 N Seh1l n/a
9 TRCN0000093268 CGATGTGTCTTTCGACTTCCA pLKO.1 182 CDS 100% 2.640 1.848 N Seh1l n/a
10 TRCN0000093265 GCAACCAAAGATGTAAGAATT pLKO.1 855 CDS 100% 0.000 0.000 N Seh1l n/a
11 TRCN0000334975 GCAACCAAAGATGTAAGAATT pLKO_005 855 CDS 100% 0.000 0.000 N Seh1l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028112.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.