Transcript: Mouse NM_028139.5

Mus musculus ataxin 7-like 1 (Atxn7l1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Atxn7l1 (380753)
Length:
1711
CDS:
50..490

Additional Resources:

NCBI RefSeq record:
NM_028139.5
NBCI Gene record:
Atxn7l1 (380753)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028139.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105007 TCCGACAATGTAGATTTAGAA pLKO.1 224 CDS 100% 5.625 7.875 N Atxn7l1 n/a
2 TRCN0000348933 GGAGGTTATGAGGCTTAATAA pLKO_005 274 CDS 100% 15.000 12.000 N Atxn7l1 n/a
3 TRCN0000105006 AGGGAGGTTATGAGGCTTAAT pLKO.1 272 CDS 100% 13.200 9.240 N Atxn7l1 n/a
4 TRCN0000105005 CCCTCCCTAACACAATGGTTT pLKO.1 1145 3UTR 100% 4.950 3.465 N Atxn7l1 n/a
5 TRCN0000105008 CAAATTACACTGCTCCGACAA pLKO.1 211 CDS 100% 4.050 2.835 N Atxn7l1 n/a
6 TRCN0000135765 CAAATTACACTGCTCCGACAA pLKO.1 211 CDS 100% 4.050 2.835 N ATXN7L1 n/a
7 TRCN0000138057 CAGGGAGGTTATGAGGCTTAA pLKO.1 271 CDS 100% 10.800 6.480 N ATXN7L1 n/a
8 TRCN0000105009 CCAGCACATGATGACTTCTAT pLKO.1 323 CDS 100% 5.625 3.375 N Atxn7l1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028139.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05270 pDONR223 100% 94.2% 91.7% None (many diffs) n/a
2 ccsbBroad304_05270 pLX_304 0% 94.2% 91.7% V5 (many diffs) n/a
3 TRCN0000467830 CACTTATTGTTCCCGTGCCTCGCA pLX_317 66.5% 94.2% 91.7% V5 (many diffs) n/a
Download CSV