Transcript: Mouse NM_028162.4

Mus musculus TBC1 domain family, member 5 (Tbc1d5), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Tbc1d5 (72238)
Length:
5616
CDS:
351..2798

Additional Resources:

NCBI RefSeq record:
NM_028162.4
NBCI Gene record:
Tbc1d5 (72238)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028162.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176628 CCCAACTTAGACTACTACAAA pLKO.1 1629 CDS 100% 5.625 7.875 N Tbc1d5 n/a
2 TRCN0000178424 GAGCCTGGTATAGCAGTATTA pLKO.1 688 CDS 100% 13.200 10.560 N Tbc1d5 n/a
3 TRCN0000197930 GCGTTGAGAATAAGGTCAATA pLKO.1 4330 3UTR 100% 13.200 9.240 N Tbc1d5 n/a
4 TRCN0000197996 CCATCAGTTCATCTCCAAGTA pLKO.1 2026 CDS 100% 4.950 3.465 N Tbc1d5 n/a
5 TRCN0000198467 GCAGGGTTTCAGATTAGGAAT pLKO.1 3273 3UTR 100% 4.950 3.465 N Tbc1d5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028162.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02241 pDONR223 100% 84.8% 86.8% None (many diffs) n/a
2 ccsbBroad304_02241 pLX_304 0% 84.8% 86.8% V5 (many diffs) n/a
Download CSV