Transcript: Mouse NM_028185.2

Mus musculus U7 snRNP-specific Sm-like protein LSM11 (Lsm11), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Lsm11 (72290)
Length:
6453
CDS:
24..1109

Additional Resources:

NCBI RefSeq record:
NM_028185.2
NBCI Gene record:
Lsm11 (72290)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028185.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123731 CTCGGCACATAAATCAGATTT pLKO.1 1045 CDS 100% 13.200 18.480 N Lsm11 n/a
2 TRCN0000123732 CTTCGACAAGTTCTGGAATAT pLKO.1 593 CDS 100% 13.200 18.480 N Lsm11 n/a
3 TRCN0000123733 GCGGATTCCAAATCTGCAGTT pLKO.1 741 CDS 100% 4.050 5.670 N Lsm11 n/a
4 TRCN0000123730 GCCTTCGACAAGTTCTGGAAT pLKO.1 591 CDS 100% 4.950 3.960 N Lsm11 n/a
5 TRCN0000123729 CGGAGCTTGAAGCTCTTTGAT pLKO.1 3122 3UTR 100% 5.625 3.938 N Lsm11 n/a
6 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 2336 3UTR 100% 4.950 2.475 Y Gad2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028185.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15246 pDONR223 68.1% 84.6% 87.9% None (many diffs) n/a
2 ccsbBroad304_15246 pLX_304 0% 84.6% 87.9% V5 (many diffs) n/a
Download CSV