Transcript: Mouse NM_028264.4

Mus musculus transmembrane protein 55A (Tmem55a), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Tmem55a (72519)
Length:
2280
CDS:
114..887

Additional Resources:

NCBI RefSeq record:
NM_028264.4
NBCI Gene record:
Tmem55a (72519)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028264.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250743 CCCAACTGTCGACGCATAATT pLKO_005 468 CDS 100% 15.000 21.000 N Tmem55a n/a
2 TRCN0000250742 TCAGCATCCCATTCGGGAAAT pLKO_005 153 CDS 100% 10.800 15.120 N Tmem55a n/a
3 TRCN0000138125 GCAATGAAGCTACGCCAATCA pLKO.1 355 CDS 100% 4.950 6.930 N PIP4P2 n/a
4 TRCN0000194530 GCGATTTCATGCAACCTATGT pLKO.1 767 CDS 100% 4.950 6.930 N Tmem55a n/a
5 TRCN0000250739 ATTTGTCCTCCCACGTTATAT pLKO_005 1139 3UTR 100% 15.000 12.000 N Tmem55a n/a
6 TRCN0000217645 GGACGCCTTCAAATCATTTAT pLKO.1 948 3UTR 100% 15.000 10.500 N Tmem55a n/a
7 TRCN0000432978 ATGTTAGATGCCCTTGTAATT pLKO_005 400 CDS 100% 13.200 9.240 N PIP4P2 n/a
8 TRCN0000193350 CTTATCTGCTAGGTTTGATTT pLKO.1 802 CDS 100% 13.200 9.240 N Tmem55a n/a
9 TRCN0000216059 CTTGTAATTGTCTACTCATTT pLKO.1 412 CDS 100% 13.200 9.240 N Tmem55a n/a
10 TRCN0000250741 CTTGTAATTGTCTACTCATTT pLKO_005 412 CDS 100% 13.200 9.240 N Tmem55a n/a
11 TRCN0000250740 GGCGCAATCAGAGTCAGTTAT pLKO_005 846 CDS 100% 13.200 9.240 N Tmem55a n/a
12 TRCN0000137916 GAGGTTCAACACTCTGGCAAA pLKO.1 611 CDS 100% 4.050 2.835 N PIP4P2 n/a
13 TRCN0000175535 CAATCTCTAATCAACCTGGAT pLKO.1 297 CDS 100% 2.640 1.848 N Tmem55a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028264.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03601 pDONR223 100% 90.5% 96.4% None (many diffs) n/a
2 ccsbBroad304_03601 pLX_304 0% 90.5% 96.4% V5 (many diffs) n/a
3 TRCN0000474631 CAAAAGTATCTTTAAGATTCCAAA pLX_317 72.4% 90.5% 96.4% V5 (many diffs) n/a
Download CSV