Transcript: Mouse NM_028284.2

Mus musculus Bardet-Biedl syndrome 5 (human) (Bbs5), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Bbs5 (72569)
Length:
1419
CDS:
30..1055

Additional Resources:

NCBI RefSeq record:
NM_028284.2
NBCI Gene record:
Bbs5 (72569)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028284.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215395 CTATTCTGCCAGTCCAATATT pLKO.1 797 CDS 100% 15.000 21.000 N Bbs5 n/a
2 TRCN0000248515 TATCTGCAAATTCGTTCAATA pLKO_005 636 CDS 100% 13.200 18.480 N Bbs5 n/a
3 TRCN0000248514 ACAAGAACTGCTAACTCTAAA pLKO_005 270 CDS 100% 13.200 10.560 N Bbs5 n/a
4 TRCN0000248516 GTTGAGCTGGACCTCTATTTA pLKO_005 1112 3UTR 100% 15.000 10.500 N Bbs5 n/a
5 TRCN0000412419 CAAGATCGTGAACCTGTATTT pLKO_005 957 CDS 100% 13.200 9.240 N BBS5 n/a
6 TRCN0000248517 TCTATTCTGCCAGTCCAATAT pLKO_005 796 CDS 100% 13.200 9.240 N Bbs5 n/a
7 TRCN0000248518 ATGTGTATGATAAGATCAATG pLKO_005 505 CDS 100% 10.800 7.560 N Bbs5 n/a
8 TRCN0000191916 GCTGGACCTCTATTTAAAGAT pLKO.1 1117 3UTR 100% 5.625 3.938 N Bbs5 n/a
9 TRCN0000200706 GAGATCAACTCACTTCACAAA pLKO.1 774 CDS 100% 4.950 3.465 N Bbs5 n/a
10 TRCN0000191917 GAGTCAATCTTTCTATTGGTT pLKO.1 226 CDS 100% 3.000 2.100 N Bbs5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028284.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09522 pDONR223 100% 88.5% 96.4% None (many diffs) n/a
2 ccsbBroad304_09522 pLX_304 0% 88.5% 96.4% V5 (many diffs) n/a
3 TRCN0000465818 CAACAGGACTGTTGGACGCTCACC pLX_317 32.1% 88.5% 96.4% V5 (many diffs) n/a
Download CSV