Transcript: Mouse NM_028312.3

Mus musculus coiled-coil domain containing 12 (Ccdc12), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Ccdc12 (72654)
Length:
845
CDS:
61..561

Additional Resources:

NCBI RefSeq record:
NM_028312.3
NBCI Gene record:
Ccdc12 (72654)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028312.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123723 CGGCGGAAAGAACGGCTGAAG pLKO.1 109 CDS 100% 0.000 0.000 N Ccdc12 n/a
2 TRCN0000123722 GAAACCTGATTGGGATCTCAA pLKO.1 390 CDS 100% 4.950 3.465 N Ccdc12 n/a
3 TRCN0000123719 TGATCTGTTCAGCACACACAT pLKO.1 582 3UTR 100% 4.950 3.465 N Ccdc12 n/a
4 TRCN0000123721 CCGCCTAGAGGAAGAGGCGCT pLKO.1 87 CDS 100% 0.000 0.000 N Ccdc12 n/a
5 TRCN0000123720 GCCAAGAAGCTAGAGAAGCTA pLKO.1 421 CDS 100% 3.000 1.800 N Ccdc12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028312.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13281 pDONR223 100% 87.7% 90.3% None (many diffs) n/a
2 ccsbBroad304_13281 pLX_304 0% 87.7% 90.3% V5 (many diffs) n/a
3 TRCN0000475515 TTGAAGCACTGCCTCCCTGGTCAG pLX_317 73.1% 87.7% 90.3% V5 (many diffs) n/a
Download CSV