Transcript: Mouse NM_028341.4

Mus musculus tetratricopeptide repeat domain 39C (Ttc39c), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ttc39c (72747)
Length:
2401
CDS:
354..2096

Additional Resources:

NCBI RefSeq record:
NM_028341.4
NBCI Gene record:
Ttc39c (72747)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028341.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379294 TTGGCGTGCGATGACTTAAAG pLKO_005 597 CDS 100% 13.200 18.480 N Ttc39c n/a
2 TRCN0000375744 GATTCATCTGTCGTTGGATTA pLKO_005 1782 CDS 100% 10.800 8.640 N Ttc39c n/a
3 TRCN0000177583 CAGAAATCATAGTCCACTAAT pLKO.1 509 CDS 100% 13.200 9.240 N Ttc39c n/a
4 TRCN0000375807 CCAGCGGTTAGAGTGTCAAAT pLKO_005 1316 CDS 100% 13.200 9.240 N Ttc39c n/a
5 TRCN0000340216 GGCCTTGGCTGGCATCAATAT pLKO_005 440 CDS 100% 13.200 9.240 N Ttc39c n/a
6 TRCN0000197733 GTCACTGACATACTAAAGATT pLKO.1 2222 3UTR 100% 5.625 3.938 N Ttc39c n/a
7 TRCN0000340215 GTCACTGACATACTAAAGATT pLKO_005 2222 3UTR 100% 5.625 3.938 N Ttc39c n/a
8 TRCN0000198917 GCAGCATGATTGAACTCAACT pLKO.1 1429 CDS 100% 4.950 3.465 N Ttc39c n/a
9 TRCN0000340214 GCAGCATGATTGAACTCAACT pLKO_005 1429 CDS 100% 4.950 3.465 N Ttc39c n/a
10 TRCN0000176817 GACATACTAAAGATTCCTCTT pLKO.1 2228 3UTR 100% 4.050 2.835 N Ttc39c n/a
11 TRCN0000182492 GCTTGGATGAAGCTAAGGCAA pLKO.1 1231 CDS 100% 2.640 1.848 N Ttc39c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028341.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04799 pDONR223 100% 80.1% 85% None (many diffs) n/a
2 ccsbBroad304_04799 pLX_304 0% 80.1% 85% V5 (many diffs) n/a
3 TRCN0000470153 TCACATTCGCGATCGCCTGCACAT pLX_317 28.3% 80.1% 85% V5 (many diffs) n/a
Download CSV