Transcript: Mouse NM_028351.3

Mus musculus R-spondin 3 (Rspo3), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rspo3 (72780)
Length:
2411
CDS:
540..1373

Additional Resources:

NCBI RefSeq record:
NM_028351.3
NBCI Gene record:
Rspo3 (72780)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028351.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090311 CAGCGAGACAAGAACTTGTAT pLKO.1 1118 CDS 100% 5.625 3.938 N Rspo3 n/a
2 TRCN0000090310 CGAGACAAGAACTTGTATAGT pLKO.1 1121 CDS 100% 5.625 3.938 N Rspo3 n/a
3 TRCN0000090312 TGCAACGTGTTCAGATTACAA pLKO.1 674 CDS 100% 5.625 3.938 N Rspo3 n/a
4 TRCN0000090309 CCAACAATCATACTATGGAAT pLKO.1 943 CDS 100% 4.950 3.465 N Rspo3 n/a
5 TRCN0000056666 CCAGCGAAGAATGCATCCTAA pLKO.1 626 CDS 100% 4.950 2.970 N RSPO3 n/a
6 TRCN0000056664 CCTTGGAAAGTGCCTTGACAA pLKO.1 902 CDS 100% 4.950 3.465 N RSPO3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028351.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04436 pDONR223 100% 89.3% 87.7% None (many diffs) n/a
2 ccsbBroad304_04436 pLX_304 0% 89.3% 87.7% V5 (many diffs) n/a
3 TRCN0000475502 GTGAGATATTAACGAGACCCATCA pLX_317 48.2% 89.3% 87.7% V5 (many diffs) n/a
Download CSV