Transcript: Mouse NM_028420.2

Mus musculus calcium/calmodulin-dependent protein kinase II inhibitor 2 (Camk2n2), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Camk2n2 (73047)
Length:
1299
CDS:
85..324

Additional Resources:

NCBI RefSeq record:
NM_028420.2
NBCI Gene record:
Camk2n2 (73047)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028420.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255333 GAAGGTTCCGACCTCTCTTTC pLKO_005 142 CDS 100% 10.800 15.120 N Camk2n2 n/a
2 TRCN0000255332 CCGGATAGACGACGTGCTGAA pLKO_005 270 CDS 100% 1.350 1.890 N Camk2n2 n/a
3 TRCN0000243329 AGGGACTTCCTCAGCACATTT pLKO_005 844 3UTR 100% 13.200 9.240 N CAMK2N2 n/a
4 TRCN0000267570 GGAGGTTTGGCTGCATATTTG pLKO_005 738 3UTR 100% 13.200 9.240 N Camk2n2 n/a
5 TRCN0000243330 TGATCGAGGATGACCGGATAG pLKO_005 257 CDS 100% 6.000 4.200 N CAMK2N2 n/a
6 TRCN0000255331 TGATCGAGGATGACCGGATAG pLKO_005 257 CDS 100% 6.000 4.200 N Camk2n2 n/a
7 TRCN0000281456 CAAGAGAGTGGTGATCGAGGA pLKO_005 246 CDS 100% 2.160 1.512 N Camk2n2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028420.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487859 GTGGACACCCTATTTCTCCAATAC pLX_317 88.5% 95.3% 98.7% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000487961 ATCGGCGAGAATGGCTCGTAACCG pLX_317 100% 94.9% 97.5% V5 (many diffs) n/a
Download CSV