Transcript: Mouse NM_028527.1

Mus musculus family with sequence similarity 177, member A (Fam177a), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Fam177a (73385)
Length:
3863
CDS:
115..738

Additional Resources:

NCBI RefSeq record:
NM_028527.1
NBCI Gene record:
Fam177a (73385)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028527.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437422 CCTTTGCACCAGGTGAGTTTA pLKO_005 1080 3UTR 100% 13.200 6.600 Y Fam177a n/a
2 TRCN0000430978 GAAGACTGTGAAGCAATTAAG pLKO_005 682 CDS 100% 13.200 6.600 Y Fam177a n/a
3 TRCN0000182583 GCGACACGGCAGATAAGTAAT pLKO.1 184 CDS 100% 13.200 6.600 Y Fam177a n/a
4 TRCN0000432395 TCTACATTAAGAGCGTGAAAT pLKO_005 1184 3UTR 100% 13.200 6.600 Y Fam177a n/a
5 TRCN0000177800 CCAGCCTTCTAAGTACCATTA pLKO.1 1897 3UTR 100% 10.800 5.400 Y Fam177a n/a
6 TRCN0000435187 GAGGAGGGTCATCCACTTTGT pLKO_005 261 CDS 100% 4.950 2.475 Y Fam177a n/a
7 TRCN0000177204 GCAGAAAGACAATACCAACAA pLKO.1 574 CDS 100% 4.950 2.475 Y Fam177a n/a
8 TRCN0000197826 GCTTTGAATCAGAAATGCAAT pLKO.1 3280 3UTR 100% 4.950 2.475 Y Fam177a n/a
9 TRCN0000440534 GGAGAGAAGATTGCGTCAGTT pLKO_005 451 CDS 100% 4.950 2.475 Y Fam177a n/a
10 TRCN0000198415 GTGTGACTTTCTTGGAGAGAA pLKO.1 438 CDS 100% 4.950 2.475 Y Fam177a n/a
11 TRCN0000439184 AGAGACAATGGAGGAGTACAG pLKO_005 288 CDS 100% 4.050 2.025 Y Fam177a n/a
12 TRCN0000418270 ATGTAGAACTGGGCGTCATGG pLKO_005 221 CDS 100% 4.050 2.025 Y Fam177a n/a
13 TRCN0000178297 GCATGGTACTACATGCCTTTA pLKO.1 1058 3UTR 100% 1.080 0.540 Y Fam177a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028527.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05363 pDONR223 100% 81.1% 83.3% None (many diffs) n/a
2 ccsbBroad304_05363 pLX_304 0% 81.1% 83.3% V5 (many diffs) n/a
3 TRCN0000465336 ACTGCCCCGGTTCACTACGAAAGA pLX_317 45.3% 81.1% 83.3% V5 (many diffs) n/a
Download CSV