Transcript: Mouse NM_028576.2

Mus musculus calmodulin-lysine N-methyltransferase (Camkmt), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Camkmt (73582)
Length:
1439
CDS:
27..998

Additional Resources:

NCBI RefSeq record:
NM_028576.2
NBCI Gene record:
Camkmt (73582)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028576.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267303 ACAGGGAAAGCGGTGGTATTT pLKO_005 786 CDS 100% 13.200 9.240 N Camkmt n/a
2 TRCN0000267301 AGCCTTGTTGATGCCATAAAG pLKO_005 750 CDS 100% 13.200 9.240 N Camkmt n/a
3 TRCN0000267302 CATCTCCGTAAGGCATAATAG pLKO_005 326 CDS 100% 13.200 9.240 N Camkmt n/a
4 TRCN0000267300 TGACTTGTGGAGCAATCTAAA pLKO_005 1254 3UTR 100% 13.200 9.240 N Camkmt n/a
5 TRCN0000129525 GTCTCTCAACTGGAAGGACAT pLKO.1 678 CDS 100% 4.050 2.835 N CAMKMT n/a
6 TRCN0000267304 GTGAGAAGATTTGAATCATTT pLKO_005 210 CDS 100% 13.200 7.920 N Camkmt n/a
7 TRCN0000148644 CGATGGGATAATGAGACAGAT pLKO.1 657 CDS 100% 4.950 3.960 N CAMKMT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028576.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08965 pDONR223 100% 87.9% 83.2% None (many diffs) n/a
2 ccsbBroad304_08965 pLX_304 0% 87.9% 83.2% V5 (many diffs) n/a
3 TRCN0000469789 GGCCGAATCTCGTCAGTGTGCGTT pLX_317 41.6% 87.9% 83.2% V5 (many diffs) n/a
Download CSV