Transcript: Mouse NM_028617.2

Mus musculus multivesicular body subunit 12A (Mvb12a), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Mvb12a (73711)
Length:
1077
CDS:
45..860

Additional Resources:

NCBI RefSeq record:
NM_028617.2
NBCI Gene record:
Mvb12a (73711)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028617.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201951 CTATGAGGCATCCAGTCTCTA pLKO.1 647 CDS 100% 4.950 3.960 N Mvb12a n/a
2 TRCN0000282987 AGACATTGAGAAGGAGTATAA pLKO_005 782 CDS 100% 13.200 9.240 N Mvb12a n/a
3 TRCN0000264307 AGTCAACGACCCTCAGGATAT pLKO_005 302 CDS 100% 10.800 7.560 N Mvb12a n/a
4 TRCN0000264308 ATCCAGTCTCTATGGCATATC pLKO_005 656 CDS 100% 10.800 7.560 N Mvb12a n/a
5 TRCN0000264306 CCTTGCAGATACTGCTGATTG pLKO_005 893 3UTR 100% 10.800 7.560 N Mvb12a n/a
6 TRCN0000164941 GCCTCTGTGTCCAAGAAGAAA pLKO.1 327 CDS 100% 5.625 3.938 N MVB12A n/a
7 TRCN0000166318 CTTTGCCATCTGGTGCAAGAA pLKO.1 464 CDS 100% 4.950 3.465 N MVB12A n/a
8 TRCN0000264309 CTTTGCCATCTGGTGCAAGAA pLKO_005 464 CDS 100% 4.950 3.465 N Mvb12a n/a
9 TRCN0000165483 GAAACGCATGTGTGTGAAGCT pLKO.1 344 CDS 100% 2.640 1.848 N MVB12A n/a
10 TRCN0000192552 GAAGGAGTATAACTATGGCTT pLKO.1 791 CDS 100% 2.640 1.848 N Mvb12a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028617.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.