Transcript: Mouse NM_028761.3

Mus musculus poly(A)-specific ribonuclease (deadenylation nuclease) (Parn), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Parn (74108)
Length:
2902
CDS:
142..2016

Additional Resources:

NCBI RefSeq record:
NM_028761.3
NBCI Gene record:
Parn (74108)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028761.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193565 GAGAGATATCAGAAGCTTAAA pLKO.1 295 CDS 100% 13.200 9.240 N Parn n/a
2 TRCN0000193532 GCGTGTGTGTTATTAACTAAT pLKO.1 2210 3UTR 100% 13.200 9.240 N Parn n/a
3 TRCN0000193830 CAAGTTTCTTTCCCTCAGATA pLKO.1 2498 3UTR 100% 4.950 3.465 N Parn n/a
4 TRCN0000193676 CCTGAATGAGTTTAAGGAGAT pLKO.1 1041 CDS 100% 4.050 2.835 N Parn n/a
5 TRCN0000173297 GCCTTCGGTAACATTCAGATT pLKO.1 1519 CDS 100% 4.950 3.960 N Parn n/a
6 TRCN0000049744 CCCAGACTCTTGGATACTAAA pLKO.1 1078 CDS 100% 13.200 9.240 N PARN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028761.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01146 pDONR223 100% 84.7% 86.5% None (many diffs) n/a
2 ccsbBroad304_01146 pLX_304 0% 84.7% 86.5% V5 (many diffs) n/a
3 TRCN0000478950 AAAGAAAACACCACATCATTTCTC pLX_317 20.5% 84.7% 86.5% V5 (many diffs) n/a
Download CSV