Transcript: Mouse NM_028803.4

Mus musculus glucan (1,4-alpha-), branching enzyme 1 (Gbe1), mRNA.

Source:
NCBI, updated 2019-05-21
Taxon:
Mus musculus (mouse)
Gene:
Gbe1 (74185)
Length:
2988
CDS:
205..2313

Additional Resources:

NCBI RefSeq record:
NM_028803.4
NBCI Gene record:
Gbe1 (74185)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028803.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093953 GCGAGATACTGTATCGCATTT pLKO.1 656 CDS 100% 10.800 15.120 N Gbe1 n/a
2 TRCN0000093949 GCGTTGGAATACGCAAACATA pLKO.1 2434 3UTR 100% 5.625 7.875 N Gbe1 n/a
3 TRCN0000093951 CGGGTGACTATAATGAATATT pLKO.1 1325 CDS 100% 15.000 12.000 N Gbe1 n/a
4 TRCN0000323749 CGGGTGACTATAATGAATATT pLKO_005 1325 CDS 100% 15.000 12.000 N Gbe1 n/a
5 TRCN0000093950 CCAGCAATGTACTACCAAGAA pLKO.1 863 CDS 100% 4.950 3.465 N Gbe1 n/a
6 TRCN0000323806 CCAGCAATGTACTACCAAGAA pLKO_005 863 CDS 100% 4.950 3.465 N Gbe1 n/a
7 TRCN0000093952 GCCAATAAGACAATCACCTTT pLKO.1 2032 CDS 100% 4.950 3.465 N Gbe1 n/a
8 TRCN0000323805 GCCAATAAGACAATCACCTTT pLKO_005 2032 CDS 100% 4.950 3.465 N Gbe1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028803.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06262 pDONR223 100% 86.6% 91.1% None (many diffs) n/a
2 ccsbBroad304_06262 pLX_304 0% 86.6% 91.1% V5 (many diffs) n/a
Download CSV