Transcript: Mouse NM_028814.3

Mus musculus RIKEN cDNA 2810403A07 gene (2810403A07Rik), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
2810403A07Rik (74200)
Length:
2999
CDS:
57..1895

Additional Resources:

NCBI RefSeq record:
NM_028814.3
NBCI Gene record:
2810403A07Rik (74200)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028814.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000189934 GCAGTGGCATAACATCCGTTA pLKO.1 2069 3UTR 100% 4.050 5.670 N 2810403A07Rik n/a
2 TRCN0000144881 GACTAATTTAGGTACAGGCTT pLKO.1 1508 CDS 100% 2.640 3.696 N KHDC4 n/a
3 TRCN0000201203 GCATTCTTTCTTTACTGGGAT pLKO.1 2478 3UTR 100% 2.640 2.112 N 2810403A07Rik n/a
4 TRCN0000190563 GCGTCTGAGATACTGTCATTT pLKO.1 2786 3UTR 100% 13.200 9.240 N 2810403A07Rik n/a
5 TRCN0000192226 CCACCATATTATCCATCCAAT pLKO.1 1116 CDS 100% 4.950 3.465 N 2810403A07Rik n/a
6 TRCN0000142264 GCTATACACAACCCTCTGCTA pLKO.1 1075 CDS 100% 2.640 1.848 N KHDC4 n/a
7 TRCN0000192143 GCTATCAGTATCCTTCATCAA pLKO.1 1831 CDS 100% 4.950 3.465 N 2810403A07Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028814.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11643 pDONR223 100% 34.9% 35.2% None (many diffs) n/a
2 ccsbBroad304_11643 pLX_304 0% 34.9% 35.2% V5 (many diffs) n/a
Download CSV