Transcript: Mouse NM_028854.3

Mus musculus TBC1 domain family, member 21 (Tbc1d21), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Tbc1d21 (74286)
Length:
1097
CDS:
45..1055

Additional Resources:

NCBI RefSeq record:
NM_028854.3
NBCI Gene record:
Tbc1d21 (74286)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028854.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252181 CATCCAGAGGCTGTATGATAA pLKO_005 419 CDS 100% 13.200 18.480 N Tbc1d21 n/a
2 TRCN0000252180 ACATCGGTGTAGGCAAGAATC pLKO_005 643 CDS 100% 10.800 8.640 N Tbc1d21 n/a
3 TRCN0000252182 ACGAGACTTCATTTGCATTAA pLKO_005 179 CDS 100% 13.200 7.920 N Tbc1d21 n/a
4 TRCN0000252179 ACTCTACTGGACCCTGAATTT pLKO_005 687 CDS 100% 13.200 7.920 N Tbc1d21 n/a
5 TRCN0000252183 GCAACAGGAGGAGGAACTATA pLKO_005 307 CDS 100% 13.200 7.920 N Tbc1d21 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028854.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05111 pDONR223 100% 87% 87.2% None (many diffs) n/a
2 ccsbBroad304_05111 pLX_304 0% 87% 87.2% V5 (many diffs) n/a
3 TRCN0000476155 AAACCCATGAGCAGATGGACCGCA pLX_317 34.7% 87% 87.2% V5 (many diffs) n/a
Download CSV