Transcript: Mouse NM_028900.4

Mus musculus golgi coiled coil 1 (Gcc1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Gcc1 (74375)
Length:
4138
CDS:
409..2745

Additional Resources:

NCBI RefSeq record:
NM_028900.4
NBCI Gene record:
Gcc1 (74375)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028900.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250559 GACTTAGAGGATGCCAATAAA pLKO_005 994 CDS 100% 15.000 10.500 N Gcc1 n/a
2 TRCN0000250557 GATGTGGTGCGTGCCTATAAA pLKO_005 517 CDS 100% 15.000 10.500 N Gcc1 n/a
3 TRCN0000250558 ACAAGTGTCAAGGGTGAATTT pLKO_005 730 CDS 100% 13.200 9.240 N Gcc1 n/a
4 TRCN0000250560 AGAGCTGAAGGACAAGTATAT pLKO_005 1983 CDS 100% 13.200 9.240 N Gcc1 n/a
5 TRCN0000250556 GATCCTGGCAGAGGTTAATTC pLKO_005 3697 3UTR 100% 13.200 9.240 N Gcc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028900.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04078 pDONR223 100% 88% 93.4% None (many diffs) n/a
2 ccsbBroad304_04078 pLX_304 0% 88% 93.4% V5 (many diffs) n/a
3 TRCN0000480444 CGATACCACCAGCCGGTTCTATGT pLX_317 17.9% 88% 93.4% V5 (many diffs) n/a
Download CSV