Transcript: Mouse NM_029004.1

Mus musculus RasGEF domain family, member 1C (Rasgef1c), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-01-20
Taxon:
Mus musculus (mouse)
Gene:
Rasgef1c (74563)
Length:
2248
CDS:
140..1540

Additional Resources:

NCBI RefSeq record:
NM_029004.1
NBCI Gene record:
Rasgef1c (74563)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029004.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180226 CGGTTTGTATTTGGCTTCCTA pLKO.1 1441 CDS 100% 3.000 4.200 N Rasgef1c n/a
2 TRCN0000047380 GAAAGCCTACATCTTCACCTT pLKO.1 316 CDS 100% 2.640 2.112 N RASGEF1C n/a
3 TRCN0000180299 CAGGGAACTTCTGCAACTATA pLKO.1 1143 CDS 100% 13.200 9.240 N Rasgef1c n/a
4 TRCN0000217244 CTGCTCATCAAGGACATTTAC pLKO.1 1244 CDS 100% 13.200 9.240 N Rasgef1c n/a
5 TRCN0000180381 GCCAAATTGCTCCAGTTGTTA pLKO.1 461 CDS 100% 5.625 3.938 N Rasgef1c n/a
6 TRCN0000178935 CACATAGTCAATCTGTCCATT pLKO.1 1800 3UTR 100% 4.950 3.465 N Rasgef1c n/a
7 TRCN0000195817 CATGGCCATTATCTCTGGCAT pLKO.1 1033 CDS 100% 2.640 1.848 N Rasgef1c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029004.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13470 pDONR223 100% 41.8% 43.6% None (many diffs) n/a
2 ccsbBroad304_13470 pLX_304 0% 41.8% 43.6% V5 (many diffs) n/a
3 TRCN0000469702 CACGGTGATGCGGATCGTGTTCAT pLX_317 65.3% 41.8% 43.6% V5 (many diffs) n/a
Download CSV