Transcript: Mouse NM_029148.1

Mus musculus thioredoxin-related transmembrane protein 4 (Tmx4), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Tmx4 (52837)
Length:
5162
CDS:
117..1124

Additional Resources:

NCBI RefSeq record:
NM_029148.1
NBCI Gene record:
Tmx4 (52837)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029148.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265666 AGGGATCTTAGGTTACATTAT pLKO_005 1114 CDS 100% 13.200 18.480 N Tmx4 n/a
2 TRCN0000252323 GCTATATGAAGGATGACTAAA pLKO_005 2342 3UTR 100% 13.200 18.480 N Tmx4 n/a
3 TRCN0000265652 ACCGTGGTCCAGGAATCTATG pLKO_005 469 CDS 100% 10.800 15.120 N Tmx4 n/a
4 TRCN0000258201 GGCGAGTGGATGCTGAAATTT pLKO_005 261 CDS 100% 15.000 9.000 N Tmx4 n/a
5 TRCN0000252324 TTAGCATCTCTGGCAAGATTT pLKO_005 595 CDS 100% 13.200 7.920 N Tmx4 n/a
6 TRCN0000064038 GATGGGATATTCCGCCGTTAT pLKO.1 450 CDS 100% 10.800 15.120 N TMX4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029148.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08637 pDONR223 99.9% 81.1% 80% None (many diffs) n/a
2 ccsbBroad304_08637 pLX_304 0% 81.1% 80% V5 (many diffs) n/a
3 TRCN0000473276 CACATCTACTGGGTCACACAGCCT pLX_317 43% 81.1% 80% V5 (many diffs) n/a
Download CSV