Transcript: Mouse NM_029169.3

Mus musculus RNA binding motif protein 6 (Rbm6), transcript variant 2, mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Rbm6 (19654)
Length:
3991
CDS:
906..3866

Additional Resources:

NCBI RefSeq record:
NM_029169.3
NBCI Gene record:
Rbm6 (19654)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029169.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427817 GTCATGTTTGCTCGATATAAA pLKO_005 3834 CDS 100% 15.000 21.000 N RBM6 n/a
2 TRCN0000295752 TCTACTACTGGCTACTATTAT pLKO_005 2880 CDS 100% 15.000 21.000 N Rbm6 n/a
3 TRCN0000151373 GAAGGAGTATAACACAGGTTA pLKO.1 1976 CDS 100% 4.950 6.930 N RBM6 n/a
4 TRCN0000054744 CGCGAGGAAATGACCAAGAAA pLKO.1 3300 CDS 100% 5.625 4.500 N Rbm6 n/a
5 TRCN0000054747 GAAGGTGATTTGGACTTTCTT pLKO.1 1671 CDS 100% 5.625 4.500 N Rbm6 n/a
6 TRCN0000349447 GAAGGTGATTTGGACTTTCTT pLKO_005 1671 CDS 100% 5.625 4.500 N Rbm6 n/a
7 TRCN0000295751 ATGGTACTCCTATGGATTATA pLKO_005 925 CDS 100% 15.000 10.500 N Rbm6 n/a
8 TRCN0000434171 GACCTTCAGGATCAAGATTAT pLKO_005 1824 CDS 100% 13.200 9.240 N RBM6 n/a
9 TRCN0000422718 GACTGGTCTTCAGATACAAAT pLKO_005 2817 CDS 100% 13.200 9.240 N RBM6 n/a
10 TRCN0000054746 GAGTCATGTTTGCTCGATATA pLKO.1 3832 CDS 100% 13.200 9.240 N Rbm6 n/a
11 TRCN0000288365 GAGTCATGTTTGCTCGATATA pLKO_005 3832 CDS 100% 13.200 9.240 N Rbm6 n/a
12 TRCN0000152100 CAAATGTAGAGGAGCATTCTT pLKO.1 706 5UTR 100% 5.625 3.938 N RBM6 n/a
13 TRCN0000054745 CCTGCTGATAAGGAGCATGAA pLKO.1 2289 CDS 100% 4.950 3.465 N Rbm6 n/a
14 TRCN0000288366 CCTGCTGATAAGGAGCATGAA pLKO_005 2289 CDS 100% 4.950 3.465 N Rbm6 n/a
15 TRCN0000054743 CCTGGAAATTCACCGGAAGAT pLKO.1 3443 CDS 100% 4.950 3.465 N Rbm6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029169.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07565 pDONR223 100% 53.1% 54.1% None (many diffs) n/a
2 ccsbBroad304_07565 pLX_304 0% 53.1% 54.1% V5 (many diffs) n/a
3 TRCN0000470808 ATATTGCACCGCAATAGTACTGAT pLX_317 27.9% 53.1% 54.1% V5 (many diffs) n/a
Download CSV