Transcript: Mouse NM_029485.2

Mus musculus spermatogenesis associated 24 (Spata24), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Spata24 (71242)
Length:
721
CDS:
59..676

Additional Resources:

NCBI RefSeq record:
NM_029485.2
NBCI Gene record:
Spata24 (71242)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029485.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000268619 ATCAACTGCGGGACGTGATTG pLKO_005 117 CDS 100% 10.800 15.120 N SPATA24 n/a
2 TRCN0000192828 GCCAAGGAAGAAGAGAAGTTA pLKO.1 281 CDS 100% 5.625 3.938 N Spata24 n/a
3 TRCN0000192589 GAAAGAGAAGATGGCCTTTGA pLKO.1 346 CDS 100% 4.950 3.465 N Spata24 n/a
4 TRCN0000268621 ATGGCAAAGAGAATGAGATTA pLKO_005 483 CDS 100% 13.200 7.920 N SPATA24 n/a
5 TRCN0000201737 GCAGCTGGAGAAAGAGAAGAT pLKO.1 337 CDS 100% 4.950 2.970 N Spata24 n/a
6 TRCN0000191766 GAAATAGAGAAGAAACTGGTG pLKO.1 221 CDS 100% 2.160 1.296 N Spata24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029485.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13392 pDONR223 100% 69.3% 64% None (many diffs) n/a
2 ccsbBroad304_13392 pLX_304 0% 69.3% 64% V5 (many diffs) n/a
3 TRCN0000472244 CTTCAACATATCCTGTAATCCCTT pLX_317 84.5% 69.3% 64% V5 (many diffs) n/a
Download CSV