Transcript: Mouse NM_029522.2

Mus musculus G-protein signalling modulator 2 (AGS3-like, C. elegans) (Gpsm2), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Gpsm2 (76123)
Length:
3510
CDS:
508..2547

Additional Resources:

NCBI RefSeq record:
NM_029522.2
NBCI Gene record:
Gpsm2 (76123)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029522.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222305 GCGCTCTACAATCTTGGAAAT pLKO.1 937 CDS 100% 10.800 15.120 N Gpsm2 n/a
2 TRCN0000292821 GCGCTCTACAATCTTGGAAAT pLKO_005 937 CDS 100% 10.800 15.120 N Gpsm2 n/a
3 TRCN0000222307 GCGTTAGAATACCACCACCAT pLKO.1 748 CDS 100% 2.640 3.696 N Gpsm2 n/a
4 TRCN0000292889 GCGTTAGAATACCACCACCAT pLKO_005 748 CDS 100% 2.640 3.696 N Gpsm2 n/a
5 TRCN0000028892 GCCGAATTGGAACAGTGAAAT pLKO.1 1773 CDS 100% 13.200 9.240 N Gpsm2 n/a
6 TRCN0000292891 GCCGAATTGGAACAGTGAAAT pLKO_005 1773 CDS 100% 13.200 9.240 N Gpsm2 n/a
7 TRCN0000222306 GCATACATATTCCTGGGTGAA pLKO.1 1258 CDS 100% 4.050 2.835 N Gpsm2 n/a
8 TRCN0000292890 GCATACATATTCCTGGGTGAA pLKO_005 1258 CDS 100% 4.050 2.835 N Gpsm2 n/a
9 TRCN0000222308 CTGATGACAAATGACAAGAAA pLKO.1 2260 CDS 100% 5.625 3.375 N Gpsm2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029522.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.