Transcript: Mouse NM_029556.3

Mus musculus citrate lyase beta like (Clybl), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Clybl (69634)
Length:
1257
CDS:
33..1049

Additional Resources:

NCBI RefSeq record:
NM_029556.3
NBCI Gene record:
Clybl (69634)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029556.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120138 CCGAGGAAGTATGATCGACAT pLKO.1 968 CDS 100% 4.050 5.670 N Clybl n/a
2 TRCN0000120141 GCCATAGATCTTGTGTACATT pLKO.1 744 CDS 100% 5.625 3.938 N Clybl n/a
3 TRCN0000120140 CCTGAAGAAATCCGATGGTTT pLKO.1 447 CDS 100% 4.950 3.465 N Clybl n/a
4 TRCN0000120139 GCAGTGGTACAGGAACAGTTT pLKO.1 858 CDS 100% 4.950 3.465 N Clybl n/a
5 TRCN0000120137 CTGAATGGATACTGTGGGCTT pLKO.1 1079 3UTR 100% 2.160 1.512 N Clybl n/a
6 TRCN0000078305 CCAGCATAGGTGCAACAAGTA pLKO.1 652 CDS 100% 4.950 3.465 N CLYBL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029556.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09785 pDONR223 100% 84% 85.2% None (many diffs) n/a
2 ccsbBroad304_09785 pLX_304 0% 84% 85.2% V5 (many diffs) n/a
3 TRCN0000467729 CAGGTACTCACGCACTCCACGGTA pLX_317 45.3% 83.9% 84.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV