Transcript: Mouse NM_029572.2

Mus musculus endoplasmic reticulum protein 44 (Erp44), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Erp44 (76299)
Length:
2647
CDS:
150..1370

Additional Resources:

NCBI RefSeq record:
NM_029572.2
NBCI Gene record:
Erp44 (76299)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029572.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099071 CCCGGCAGTTGATAAGTGAAA pLKO.1 1000 CDS 100% 4.950 6.930 N Erp44 n/a
2 TRCN0000287895 CCCGGCAGTTGATAAGTGAAA pLKO_005 1000 CDS 100% 4.950 6.930 N Erp44 n/a
3 TRCN0000099072 CCAGCGAGTATAGGTATACTT pLKO.1 1324 CDS 100% 0.563 0.788 N Erp44 n/a
4 TRCN0000287971 CCAGCGAGTATAGGTATACTT pLKO_005 1324 CDS 100% 0.563 0.788 N Erp44 n/a
5 TRCN0000099070 GTGGAAATAGTGAACCTATAT pLKO.1 1419 3UTR 100% 13.200 10.560 N Erp44 n/a
6 TRCN0000288023 GTGGAAATAGTGAACCTATAT pLKO_005 1419 3UTR 100% 13.200 10.560 N Erp44 n/a
7 TRCN0000295262 ACCAATCTTGATCGCAGTAAG pLKO_005 609 CDS 100% 10.800 7.560 N Erp44 n/a
8 TRCN0000295261 GTAACCCAGTCCACGAGATTC pLKO_005 571 CDS 100% 10.800 7.560 N Erp44 n/a
9 TRCN0000099074 CTGATGTCATTAAGGAAGAAT pLKO.1 364 CDS 100% 5.625 3.938 N Erp44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029572.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02718 pDONR223 100% 89.9% 93.1% None (many diffs) n/a
2 ccsbBroad304_02718 pLX_304 0% 89.9% 93.1% V5 (many diffs) n/a
3 TRCN0000472813 CAAGGACCGATATGTAAGTTGTCA pLX_317 36% 89.9% 93.1% V5 (many diffs) n/a
Download CSV