Transcript: Mouse NM_029576.3

Mus musculus RAB1B, member RAS oncogene family (Rab1b), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Rab1b (76308)
Length:
1835
CDS:
59..664

Additional Resources:

NCBI RefSeq record:
NM_029576.3
NBCI Gene record:
Rab1b (76308)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029576.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379948 ACACCACGGCCAAGGAATTTG pLKO_005 456 CDS 100% 13.200 9.240 N Rab1b n/a
2 TRCN0000381762 AGTCCTACGCCAACGTGAAAC pLKO_005 339 CDS 100% 10.800 7.560 N Rab1b n/a
3 TRCN0000100821 GCCAAGAATGCCACCAATGTT pLKO.1 512 CDS 100% 5.625 3.938 N Rab1b n/a
4 TRCN0000302711 GCCAAGAATGCCACCAATGTT pLKO_005 512 CDS 100% 5.625 3.938 N Rab1b n/a
5 TRCN0000100823 CATGGCATCATTGTGGTGTAT pLKO.1 302 CDS 100% 4.950 3.465 N Rab1b n/a
6 TRCN0000302712 CATGGCATCATTGTGGTGTAT pLKO_005 302 CDS 100% 4.950 3.465 N Rab1b n/a
7 TRCN0000100820 CCACGCACCTTTCTTTGGAAT pLKO.1 918 3UTR 100% 4.950 3.465 N Rab1b n/a
8 TRCN0000302710 CCACGCACCTTTCTTTGGAAT pLKO_005 918 3UTR 100% 4.950 3.465 N Rab1b n/a
9 TRCN0000047215 GACCATCACTTCCAGCTACTA pLKO.1 271 CDS 100% 4.950 3.465 N RAB1B n/a
10 TRCN0000299460 GACCATCACTTCCAGCTACTA pLKO_005 271 CDS 100% 4.950 3.465 N RAB1B n/a
11 TRCN0000100822 GATTTCAAGATTCGAACCATT pLKO.1 188 CDS 100% 4.950 3.465 N Rab1b n/a
12 TRCN0000100824 GCGGTTTGCTGATGACACTTA pLKO.1 136 CDS 100% 4.950 3.465 N Rab1b n/a
13 TRCN0000302786 GCGGTTTGCTGATGACACTTA pLKO_005 136 CDS 100% 4.950 3.465 N Rab1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029576.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04261 pDONR223 100% 91.2% 99% None (many diffs) n/a
2 ccsbBroad304_04261 pLX_304 0% 91.2% 99% V5 (many diffs) n/a
3 TRCN0000465917 TCTGCGTGGACTTTCAGGGTCAGA pLX_317 52.8% 91.2% 99% V5 (many diffs) n/a
Download CSV