Construct: ORF TRCN0000465917
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014230.1_s317c1
- Derived from:
- ccsbBroadEn_04261
- DNA Barcode:
- TCTGCGTGGACTTTCAGGGTCAGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RAB1B (81876)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465917
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 81876 | RAB1B | RAB1B, member RAS oncogene ... | NM_030981.3 | 100% | 100% | |
| 2 | human | 81876 | RAB1B | RAB1B, member RAS oncogene ... | XM_017018378.1 | 84.8% | 84.8% | 410_517del |
| 3 | human | 5861 | RAB1A | RAB1A, member RAS oncogene ... | NM_004161.5 | 74.9% | 91.7% | (many diffs) |
| 4 | human | 5861 | RAB1A | RAB1A, member RAS oncogene ... | XM_005264468.2 | 63.2% | 76% | (many diffs) |
| 5 | mouse | 76308 | Rab1b | RAB1B, member RAS oncogene ... | NM_029576.3 | 91.2% | 99% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 669
- ORF length:
- 603
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa ccccgaatat gactacctgt ttaagctgct tttgattggc gactcaggcg 121 tgggcaagtc atgcctgctc ctgcggtttg ctgatgacac gtacacagag agctacatca 181 gcaccatcgg ggtggacttc aagatccgaa ccatcgagct ggatggcaaa actatcaaac 241 ttcagatctg ggacacagcg ggccaggaac ggttccggac catcacttcc agctactacc 301 ggggggctca tggcatcatc gtggtgtatg acgtcactga ccaggaatcc TACGCCAACG 361 TGAAGCAGTG GCTGCAGGAG ATTGACCGCT ATGCCAGCGA GAACGTCAAT AAGCTCCTGG 421 TGGGCAACAA GAGCGACCTC ACCACCAAGA AGGTGGTGGA CAACACCACA GCCAAGGAGT 481 TTGCAGACTC TCTGGGCATC CCCTTCTTGG AGACGAGCGC CAAGAATGCC ACCAATGTCG 541 AGCAGGCGTT CATGACCATG GCTGCTGAAA TCAAAAAGCG GATGGGGCCT GGAGCAGCCT 601 CTGGGGGCGA GCGGCCCAAT CTCAAGATCG ACAGCACCCC TGTAAAGCCG GCTGGCGGTG 661 GCTGTTGCTA CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 721 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 781 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGATCTGCG TGGACTTTCA GGGTCAGAAC 841 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt