Transcript: Mouse NM_029654.4

Mus musculus autophagy related 2B (Atg2b), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Atg2b (76559)
Length:
10173
CDS:
412..6639

Additional Resources:

NCBI RefSeq record:
NM_029654.4
NBCI Gene record:
Atg2b (76559)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029654.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336214 ATGGAATTAAACCGGTATTAT pLKO_005 1513 CDS 100% 15.000 21.000 N Atg2b n/a
2 TRCN0000365229 ATGGAATTAAACCGGTATTAT pLKO_005 1513 CDS 100% 15.000 21.000 N ATG2B n/a
3 TRCN0000216504 CGTCCTATAACAAGCATATTA pLKO.1 2546 CDS 100% 15.000 21.000 N Atg2b n/a
4 TRCN0000201401 GCCGTCCGATATGTTGTTAAA pLKO.1 5041 CDS 100% 13.200 18.480 N Atg2b n/a
5 TRCN0000336272 GCTGACCATAACCGCAGTAAA pLKO_005 4356 CDS 100% 13.200 18.480 N Atg2b n/a
6 TRCN0000336216 TGCGAGCTGGATATCAGTATT pLKO_005 2452 CDS 100% 13.200 18.480 N Atg2b n/a
7 TRCN0000201385 GCTGGCTAATAAAGACAGGAA pLKO.1 1452 CDS 100% 2.640 3.696 N Atg2b n/a
8 TRCN0000216918 CATTTGCATTCGCTCGATTTC pLKO.1 8014 3UTR 100% 10.800 8.640 N Atg2b n/a
9 TRCN0000202165 CGAGGCGACATCAAATGTGTT pLKO.1 6543 CDS 100% 4.950 3.960 N Atg2b n/a
10 TRCN0000353311 ACACGATCACCTTAGGTTTAT pLKO_005 2124 CDS 100% 13.200 9.240 N Atg2b n/a
11 TRCN0000336271 GGTGTCAGTCACTAGAGATTT pLKO_005 6842 3UTR 100% 13.200 9.240 N Atg2b n/a
12 TRCN0000191259 CGGTATTATCTGAGGAAAGAT pLKO.1 1525 CDS 100% 5.625 3.938 N Atg2b n/a
13 TRCN0000191218 CTGGCTAATAAAGACAGGAAA pLKO.1 1453 CDS 100% 4.950 3.465 N Atg2b n/a
14 TRCN0000190602 GCTGCACTTGAAATCCGAGTA pLKO.1 967 CDS 100% 4.050 2.835 N Atg2b n/a
15 TRCN0000200572 CTATGCATTCACTAGTTCAAT pLKO.1 6080 CDS 100% 0.000 0.000 N Atg2b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029654.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12156 pDONR223 100% 29.6% 30.9% None (many diffs) n/a
2 ccsbBroad304_12156 pLX_304 0% 29.6% 30.9% V5 (many diffs) n/a
Download CSV