Transcript: Mouse NM_029726.2

Mus musculus triadin (Trdn), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Trdn (76757)
Length:
4514
CDS:
242..2323

Additional Resources:

NCBI RefSeq record:
NM_029726.2
NBCI Gene record:
Trdn (76757)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029726.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000174601 GCTATCGTGATGTTTGATTTA pLKO.1 431 CDS 100% 13.200 18.480 N Trdn n/a
2 TRCN0000152008 CAGTATGCATTCTGTCGATAT pLKO.1 1031 CDS 100% 10.800 7.560 N TRDN n/a
3 TRCN0000175887 GCAACTCACAAAGAGAAACTT pLKO.1 791 CDS 100% 5.625 3.938 N Trdn n/a
4 TRCN0000176411 GAAATAGAAGAACCTCCCTTA pLKO.1 638 CDS 100% 4.050 2.835 N Trdn n/a
5 TRCN0000174633 GCAGATGAAGACATTGATAAA pLKO.1 614 CDS 100% 13.200 7.920 N Trdn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029726.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11486 pDONR223 100% 20.9% 20.7% None (many diffs) n/a
2 ccsbBroad304_11486 pLX_304 0% 20.9% 20.7% V5 (many diffs) n/a
3 TRCN0000481515 ACTGCCGGCGACGTACGGTTCCAG pLX_317 98.4% 20.9% 20.7% V5 (many diffs) n/a
Download CSV