Transcript: Mouse NM_029797.3

Mus musculus meiotic nuclear divisions 1 (Mnd1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Mnd1 (76915)
Length:
874
CDS:
123..740

Additional Resources:

NCBI RefSeq record:
NM_029797.3
NBCI Gene record:
Mnd1 (76915)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029797.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246935 AGCCTAGTGGATGACGGTATG pLKO_005 279 CDS 100% 6.000 3.600 N Mnd1 n/a
2 TRCN0000192890 GAGACCAAAGGCAACAACTTA pLKO.1 514 CDS 100% 5.625 3.375 N Mnd1 n/a
3 TRCN0000246934 ACCCGGATGATGGAGATATTT pLKO_005 162 CDS 100% 15.000 7.500 Y Mnd1 n/a
4 TRCN0000215715 CGATGGACTGATAACATATTT pLKO.1 624 CDS 100% 15.000 7.500 Y Mnd1 n/a
5 TRCN0000425400 ACTTTGACTACATAGACTAAA pLKO_005 721 CDS 100% 13.200 6.600 Y MND1 n/a
6 TRCN0000246936 AGGATCGGGACGTCCAATTAC pLKO_005 312 CDS 100% 13.200 6.600 Y Mnd1 n/a
7 TRCN0000246933 ATCGATGGACTGATAACATAT pLKO_005 622 CDS 100% 13.200 6.600 Y Mnd1 n/a
8 TRCN0000216371 GAAGCAAATAAAGTAGCTAAA pLKO.1 591 CDS 100% 10.800 5.400 Y Mnd1 n/a
9 TRCN0000246932 GAAGCAAATAAAGTAGCTAAA pLKO_005 591 CDS 100% 10.800 5.400 Y Mnd1 n/a
10 TRCN0000191251 CCAGAAGACTTTGACTACATA pLKO.1 714 CDS 100% 5.625 2.813 Y Mnd1 n/a
11 TRCN0000190676 GCTCCCAAAGAGAAAGGCATA pLKO.1 228 CDS 100% 4.050 2.025 Y Mnd1 n/a
12 TRCN0000137313 GCTCCCAAAGAGAAAGGCATT pLKO.1 228 CDS 100% 4.050 2.025 Y MND1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029797.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04318 pDONR223 100% 86% 89.7% None (many diffs) n/a
2 ccsbBroad304_04318 pLX_304 0% 86% 89.7% V5 (many diffs) n/a
3 TRCN0000466193 TTTCGGACACACCTGAGTGTAAGC pLX_317 54.8% 86% 89.7% V5 (many diffs) n/a
Download CSV