Transcript: Mouse NM_029875.2

Mus musculus solute carrier family 35, member E3 (Slc35e3), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Slc35e3 (215436)
Length:
3508
CDS:
173..1114

Additional Resources:

NCBI RefSeq record:
NM_029875.2
NBCI Gene record:
Slc35e3 (215436)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029875.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069473 GCTGTCTGGAATAATCGCTTT pLKO.1 856 CDS 100% 4.050 5.670 N Slc35e3 n/a
2 TRCN0000069474 CGGAGGATACATTCTATTTAA pLKO.1 970 CDS 100% 15.000 10.500 N Slc35e3 n/a
3 TRCN0000069477 CCTCACCTACACCCACTTTAA pLKO.1 1045 CDS 100% 13.200 9.240 N Slc35e3 n/a
4 TRCN0000043710 CGGACACTTCAAGTTCTGCAT pLKO.1 940 CDS 100% 2.640 1.848 N SLC35E3 n/a
5 TRCN0000069475 GAAGAGATTCTCCGTCAGAAT pLKO.1 541 CDS 100% 0.495 0.347 N Slc35e3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029875.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03598 pDONR223 100% 89.4% 92.3% None (many diffs) n/a
2 ccsbBroad304_03598 pLX_304 0% 89.4% 92.3% V5 (many diffs) n/a
3 TRCN0000473034 CTCTTACCGCGGATAGGTAGGCTT pLX_317 54.5% 89.4% 92.3% V5 (many diffs) n/a
Download CSV